Sequence ID | >W1711606631 |
Genome ID | MORM01000003 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio parahaemolyticus [MORM] |
Start position on genome | 34269 |
End posion on genome | 34193 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccagaggtat |
tRNA gene sequence |
GCGTCCGTAGCTCAGCTGGTTAGAGTATCGCCTTGACATGGCGGGGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
ttctgaattg |
Secondary structure (Cloverleaf model) | >W1711606631 Val GAC t ACCA ttctgaattg G - C C - G G - C T - A C - G C - G G - C T G T T C A C C A C G A A + | | | | G T C T C G G G T G G C G | | | + T T G G A G T T T A A GGGTC T + G C - G G - C C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |