Sequence ID | >W1711618700 |
Genome ID | MPBN01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa [MPBN] |
Start position on genome | 915593 |
End posion on genome | 915669 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cccccacgac |
tRNA gene sequence |
GCACTCATAGCTCAGCTGGATAGAGTACTCGGCTACGAACCGAGCGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tatttcgaag |
Secondary structure (Cloverleaf model) | >W1711618700 Arg ACG c GCCA tatttcgaag G - C C - G A - T C - G T - A C - G A - T T A T C C T C C A C G A A | | | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A CGGTC C - G T - A C - G G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |