Sequence ID | >W1711621232 |
Genome ID | MPCX01000001 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Lacinutrix sp. MedPE-SW [MPCX] |
Start position on genome | 390514 |
End posion on genome | 390601 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaggcactca |
tRNA gene sequence |
GGAGAAATGGCAGAGTGGTCGAATGCGGCAGTCTTGAAAACTGTTGAGGGTCACACCTCC |
Downstream region at tRNA end position |
aacccttgtt |
Secondary structure (Cloverleaf model) | >W1711621232 Ser TGA a GCAA aacccttgtt G - C G - C A - T G - C A - T A - T A - T T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G | | | T T T A T G C C G A G TGAGGGTCACACCTCC G + T C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |