| Sequence ID | >W1711629255 |
| Genome ID | MPOT01000057 |
| Phylum/Class | Bacillota |
| Species | Tepidanaerobacter sp. EBM-38 [MPOT] |
| Start position on genome | 33193 |
| End posion on genome | 33120 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
ttagcaatga |
| tRNA gene sequence |
TGCGGGATTGTGTAACGGTAGCACCCATGACTCTGGATCATGTTGTCCAGGTTCGAATCC |
| Downstream region at tRNA end position |
tggccatatc |
| Secondary structure (Cloverleaf model) | >W1711629255 Gln CTG
a GCCA tggccatatc
T - A
G - C
C - G
G - C
G - C
G - C
A - T T A
T G G T C C A
A A T | | | | | G
C T G T G C C A G G C
G + | | | T T
G G C A C
T A C TTGT
C - G
A - T
T - A
G - C
A - T
C A
T G
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |