Sequence ID | >W1711643084 |
Genome ID | MPZV01000005 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Thioclava sediminum TAW-CT134 [MPZV] |
Start position on genome | 267596 |
End posion on genome | 267520 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gagagggcgt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCGTCTGTTTTGGGTACAGAAGGTCGTGAGTTCGAA |
Downstream region at tRNA end position |
tcccctcgaa |
Secondary structure (Cloverleaf model) | >W1711643084 Pro TGG t ACCA tcccctcgaa C - G G - C G - C G - C G - C C - G G - C T A T C G C T C A C G A A | + | | | G C C G C G G T G A G C T | | | | T T G G C G C G T A G AGGTC T - A C - G T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |