Sequence ID | >W1711658840 |
Genome ID | MQNP01000060 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Stenotrophomonas sp. KAs 5-3 [MQNP] |
Start position on genome | 3415 |
End posion on genome | 3339 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acacttccgg |
tRNA gene sequence |
TGCGGGGTGGAGCAGTCTGGCAGCTCGTCGGGCTCATAACCCGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
acctcagatc |
Secondary structure (Cloverleaf model) | >W1711658840 Met CAT g ACCA acctcagatc T T G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | | | | | A C C G A G G C A G G C T | | | | T T G G C T C G C A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |