Sequence ID | >W1711666934 |
Genome ID | MRDC01000007 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Ehrlichia ruminantium [MRDC] |
Start position on genome | 308800 |
End posion on genome | 308727 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
taatgtaata |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTAGAGCATCTCGTTTACACCGAGGAGGTCAGCAGTTCAAGT |
Downstream region at tRNA end position |
ttttatctat |
Secondary structure (Cloverleaf model) | >W1711666934 Val TAC a ACtc ttttatctat G - C G - C G - C C - G G - C A - T T - A T G T T T G T C A T G A A | + | | | A T C T C G A G C A G C G | | | | T T G G A G C T A A AGGTC T + G C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |