Sequence ID | >W1711667445 |
Genome ID | MRDM01000014 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhizobium laguerreae [MRDM] |
Start position on genome | 1209994 |
End posion on genome | 1210070 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ccttaggcat |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGTGTTGGATTCCGATTCCAAAGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
cttccccttt |
Secondary structure (Cloverleaf model) | >W1711667445 Arg CCG t GCCA cttccccttt G - C C - G A - T C - G C - G C - G G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | + T T G G A G T A T A G AGGTC T - A T - A G - C G - C A - T T T T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |