Sequence ID | >W1711690388 |
Genome ID | MSEN01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio cholerae [MSEN] |
Start position on genome | 392871 |
End posion on genome | 392956 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tgcatttaac |
tRNA gene sequence |
GCGGTGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCTTAGGACGTGA |
Downstream region at tRNA end position |
aatgtatcga |
Secondary structure (Cloverleaf model) | >W1711690388 Leu CAG c ACCA aatgtatcga G - C C - G G - C G - C T T G + T G - C T G T C T C C C A T A A G | | | | | A T G G C G G A G G G C G | | | T T G A C G C T A G G TGTCCTTAGGACGT C - G T - A A - T G + T C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |