Sequence ID | >W1711697648 |
Genome ID | MSKN01000054 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces oris [MSKN] |
Start position on genome | 4181 |
End posion on genome | 4265 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gcaccgcgca |
tRNA gene sequence |
GCGCGAGTGGCGGAATTGGTAGACGCCCCAGGTTTAGGTCCTGGTGCCTTCGGGCGTGAG |
Downstream region at tRNA end position |
cagcatcgct |
Secondary structure (Cloverleaf model) | >W1711697648 Leu TAG a ACCA cagcatcgct G - C C - G G - C C - G G - C A - T G - C T G T T T C C C A T A A G + | | | | G T G G C G G A G G G C G | | | T T G A C G C T A G C TGCCTTCGGGCGT C - G C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |