Sequence ID | >W1711697762 |
Genome ID | MSKQ01000030 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces oris [MSKQ] |
Start position on genome | 47882 |
End posion on genome | 47794 |
Amino Acid | Pseudo |
Anticodon | CGA |
Upstream region at tRNA start position |
tcgtagtcga |
tRNA gene sequence |
GGTAGCGTGTCCGAGCGGCCGAAGGTGCAGATCTCGAAAGTCTGTGTGGTTCATAGCCAC |
Downstream region at tRNA end position |
ccacggcgag |
Secondary structure (Cloverleaf model) | >W1711697762 Pseudo CGA a GCCA ccacggcgag G - C G - C T - A A - T G - C C - G G - C T A T G A C C C A C G A G | | | | | G G G C C T C T G G G C G | | T T C A G G T C G A G TGTGGTTCATAGCCACC C - G A - T G - C A - T T + G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |