Sequence ID | >W1711697816 |
Genome ID | MSKR01000016 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces oris [MSKR] |
Start position on genome | 30103 |
End posion on genome | 30019 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ggcacgtctt |
tRNA gene sequence |
GCCTCCGTGGTGGAATCGGTAGACACCGCGACCTTAAAAGTCGCTGCCTACGGGCGTGCG |
Downstream region at tRNA end position |
cagcatcgct |
Secondary structure (Cloverleaf model) | >W1711697816 Leu TAA t ACCA cagcatcgct G - C C - G C - G T - A C - G C - G G - C T G T C G C C C A T A A G | | | | | G C G G T G G C G G G C G | | | T T G A C A C T A G C TGCCTACGGGCGT G - C C - G G - C A - T C - G C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |