Sequence ID | >W1711699716 |
Genome ID | MSLT01000023 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Thioflexithrix psekupsensis psekupsii [MSLT] |
Start position on genome | 25073 |
End posion on genome | 24998 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
aatgttttac |
tRNA gene sequence |
GCCCATATAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCACCGGTTCAAGT |
Downstream region at tRNA end position |
aaatcgatag |
Secondary structure (Cloverleaf model) | >W1711699716 Thr GGT c TCCA aaatcgatag G - C C - G C - G C - G A - T T - A A - T T G T T G G C C A T G A A | | | | | A C C T C G A C C G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |