Sequence ID | >W1711707327 |
Genome ID | MSRU01000020 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces naeslundii [MSRU] |
Start position on genome | 30776 |
End posion on genome | 30702 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aattcacact |
tRNA gene sequence |
GGCCTCGTGGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCAAG |
Downstream region at tRNA end position |
aaaggatcgg |
Secondary structure (Cloverleaf model) | >W1711707327 Asp GTC t GCgg aaaggatcgg G - C G + T C - G C - G T - A C - G G - C T G T T G C C C A T G A G + | | | | A T C G C G G C G G G C G | | | | T T G G C G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |