Sequence ID | >W1711711368 |
Genome ID | MTAW01000113 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Nostoc sp. 106C [MTAW] |
Start position on genome | 2349 |
End posion on genome | 2422 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tcgtgagcgT |
tRNA gene sequence |
TCCTCAGTAGCTCAGTGGTAGAGCGATCGACTGTTAATCGATTGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
aaaaaggata |
Secondary structure (Cloverleaf model) | >W1711711368 Asn GTT T GTta aaaaaggata T - A C - G C - G T + G C - G A - T G - C T A T C G A C C A G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A G TGGTC A - T T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |