Sequence ID | >W1711711422 |
Genome ID | MTAX01000046 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Nostoc sp. RF31YmG RF31Y [MTAX] |
Start position on genome | 232774 |
End posion on genome | 232692 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ggaaactgat |
tRNA gene sequence |
GCGGATGTGGCGGAATTGGCAGACGCGCTAGATTTAGGTTCTAGTTCCGAGAGGAGTGAA |
Downstream region at tRNA end position |
ttaagtaata |
Secondary structure (Cloverleaf model) | >W1711711422 Leu TAG t ACtt ttaagtaata G - C C - G G - C G - C A - T T - A G - C T G T T T T C C A T A A G + | | | | A T G G C G G A A G G C G | | | T T G A C G C C A G G TTCCGAGAGGAGT C - G T - A A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |