| Sequence ID | >W1711712842 |
| Genome ID | MTCO01000011 |
| Phylum/Class | Alphaproteobacteria |
| Species | Brevirhabdus pacifica [MTCO] |
| Start position on genome | 14375 |
| End posion on genome | 14302 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
gtccccggtt |
| tRNA gene sequence |
GGCGAGTTGGCGGAGTGGTTACGCAGCGGATTGCAAATCCGTGTACACCGGTTCGATTCC |
| Downstream region at tRNA end position |
tcatttcaat |
| Secondary structure (Cloverleaf model) | >W1711712842 Cys GCA
t TCCA tcatttcaat
G - C
G - C
C - G
G - C
A - T
G - C
T - A T T
T T G G C C A
G A G | | | | | G
T G G C G A C C G G C
G | | | T T
G A C G C
T T A GTAC
G + T
C - G
G - C
G - C
A - T
T A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |