Sequence ID | >W1711723471 |
Genome ID | MTPJ01000001 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Lawsonia intracellularis [MTPJ] |
Start position on genome | 112319 |
End posion on genome | 112411 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gtcaaattgg |
tRNA gene sequence |
GGAGAGGTGGCCGAGCTGGCTGAAGGCGCTCGCCTGCTAAGCGAGTATACGGATAAAACT |
Downstream region at tRNA end position |
tttttatttt |
Secondary structure (Cloverleaf model) | >W1711723471 Ser GCT g GCCA tttttatttt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T C G A G | | | | | A G G C C G G A G G G C G | | | T T C A G G C T G A G TATACGGATAAAACTGTATC C - G T - A C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |