Sequence ID | >W1711748659 |
Genome ID | MULM01000151 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. VI4.1 [MULM] |
Start position on genome | 12298 |
End posion on genome | 12225 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agatgtttga |
tRNA gene sequence |
GGCCGAGTAGCAAAATGGTTATGCAGTGGATTGCAAATCCACCTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
ctttaaacaa |
Secondary structure (Cloverleaf model) | >W1711748659 Cys GCA a TCCA ctttaaacaa G - C G - C C - G C - G G - C A - T G - C T T T C A G C C A A A A | | | | G T A A C G G C C G G C G | | | T T G A T G C T T A CTAC G - C T - A G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |