Sequence ID | >W1711751600 |
Genome ID | MUNW01000063 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sinorhizobium sp. A49 [MUNW] |
Start position on genome | 250098 |
End posion on genome | 250022 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
ccgctggtca |
tRNA gene sequence |
CGGAGTGTAGCGCAGTCTGGTAGCGCACCACGTTCGGGACGTGGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
gcttgaaacc |
Secondary structure (Cloverleaf model) | >W1711751600 Pro CGG a ACCA gcttgaaacc C - G G - C G - C A - T G - C T - A G - C T A T T C T C C A T G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |