Sequence ID | >W1711772240 |
Genome ID | MVHE01000068 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium angelicum [MVHE] |
Start position on genome | 812 |
End posion on genome | 736 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
aagcttcaag |
tRNA gene sequence |
CGGGGTGTGGCGCAGCTTGGTAGCGCGCTTCGTTCGGGACGAAGAGGCCGTGGGTTCGAA |
Downstream region at tRNA end position |
gtgttctaac |
Secondary structure (Cloverleaf model) | >W1711772240 Pro CGG g ACCA gtgttctaac C - G G - C G - C G - C G - C T - A G - C T A T C G C C C A C G A G | + | | | G T C G C G G T G G G C T | | | | T T G G C G C G T A G AGGCC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |