Sequence ID | >W1711772497 |
Genome ID | MVHL01000009 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycobacterium bouchedurhonense [MVHL] |
Start position on genome | 4494 |
End posion on genome | 4421 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cgggccgtcc |
tRNA gene sequence |
GCCCTCGTAGCTCAGGGGATAGAGCACGGCTCTCCTAAAGCCGGTGTCGCAGGTTCGAAT |
Downstream region at tRNA end position |
gtggggcaca |
Secondary structure (Cloverleaf model) | >W1711772497 Arg CCT c ACag gtggggcaca G - C C - G C - G C - G T + G C - G G - C T A T C G T C C A G G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A A GTGTC C - G G - C G - C C - G T - A C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |