Sequence ID | >W1711774062 |
Genome ID | MVIV01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Actinomyces gaoshouyii pika_113 [MVIV] |
Start position on genome | 80812 |
End posion on genome | 80741 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gcatctcact |
tRNA gene sequence |
GGTGGGTTGGCCGAGAGGCTAGGCACCGGCCTGCAAAGCCGTTTACACCGGTTCGAATCC |
Downstream region at tRNA end position |
gcgattggcg |
Secondary structure (Cloverleaf model) | >W1711774062 Cys GCA t TCgg gcgattggcg G - C G - C T - A G - C G - C G - C T - A T A T T G G C C A G A G | | | | | G A G C C G A C C G G C G | | | T T G A G G C C T A TTAC C T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |