Sequence ID | >W1711781578 |
Genome ID | MVMX01000035 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Escherichia coli [MVMX] |
Start position on genome | 36494 |
End posion on genome | 36570 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cggtatcaac |
tRNA gene sequence |
GCGCCCTTAGCTCAGTTGGATAGAGCAACGACCTTCTAAGTCGTGGGCCGCAGGTTCGAA |
Downstream region at tRNA end position |
ttacaattca |
Secondary structure (Cloverleaf model) | >W1711781578 Arg TCT c GCCA ttacaattca G - C C - G G - C C - G C - G C - G T - A T A T C G T C C A T G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G G - C A - T C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |