Sequence ID | >W1711797294 |
Genome ID | MWRZ01000014 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Zobellia sp. OII3 galactanivorans [MWRZ] |
Start position on genome | 29190 |
End posion on genome | 29116 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
aacctaataa |
tRNA gene sequence |
GCCGACGTAGCTCAGGGGTAGAGCGTTTCCTTGGTAAGGAAGAGGTCACGGGTTCAATTC |
Downstream region at tRNA end position |
ctaaggcatt |
Secondary structure (Cloverleaf model) | >W1711797294 Thr GGT a TCAA ctaaggcatt G - C C - G C - G G + T A - T C - G G - C T T T T G C C C A G A A | | | | | A G C T C G A C G G G C G | | | | T T G G A G C T A G AGGTC T + G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |