Sequence ID | >W1711799393 |
Genome ID | MWZB01000076 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Bacillus spizizenii intestinalis [MWZB] |
Start position on genome | 645 |
End posion on genome | 570 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
taaataataa |
tRNA gene sequence |
GGCTCGGTAGCTCAGTTGGTAGAGCAACGGACTGAAAATCCGTGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
cctatgccgg |
Secondary structure (Cloverleaf model) | >W1711799393 Phe GAA a ACCA cctatgccgg G - C G - C C - G T - A C - G G - C G - C T T T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC A - T C - G G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |