Sequence ID | >W1711926574 |
Genome ID | NADQ01000105 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Geobacillus sp. 44C [NADQ] |
Start position on genome | 1833 |
End posion on genome | 1758 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tgtttcttat |
tRNA gene sequence |
GCCGACTTAGCTCAATTGGTAGAGCAACTGAATCGTAATCAGTAGGTTGCGGGTTCAAGT |
Downstream region at tRNA end position |
tggttacgga |
Secondary structure (Cloverleaf model) | >W1711926574 Thr CGT t ACCA tggttacgga G - C C - G C - G G - C A - T C - G T - A T G T C G T C C A T A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTT A - T C - G T - A G - C A - T A A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |