Sequence ID | >W1711980248 |
Genome ID | NDHR01000004 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium diphtheriae [NDHR] |
Start position on genome | 144451 |
End posion on genome | 144524 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
aggaacgaat |
tRNA gene sequence |
GGGGCATTAGCTCAATTGGTAGAGCATCTGCTTTGCAAGCAGAAGGTCAGGAGTTCGATT |
Downstream region at tRNA end position |
tgtggaaccc |
Secondary structure (Cloverleaf model) | >W1711980248 Ala TGC t ACag tgtggaaccc G - C G - C G + T G - C C - G A - T T - A T T T T C C T C A T A A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C T A A AGGTC T - A C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |