Sequence ID | >W1712005783 |
Genome ID | NEHS01000007 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. R33(2017) [NEHS] |
Start position on genome | 203010 |
End posion on genome | 202924 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ctgtcgagat |
tRNA gene sequence |
GCCCAGGTGGTGAAATTGGTAGACACGCCAGCTTCAGGTGCTGGTGACCTTACGGTCGTG |
Downstream region at tRNA end position |
atttcgagtt |
Secondary structure (Cloverleaf model) | >W1712005783 Leu CAG t ACCA atttcgagtt G - C C - G C - G C - G A - T G - C G - C T G T T C T T C A T A A G + | | | | G T A G T G G G A A G C G | | | T T G A C A C T A G G TGACCTTACGGTCGT C - G C - G A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |