Sequence ID | >W1712005963 |
Genome ID | NEHV01000014 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. R29(2017) [NEHV] |
Start position on genome | 126537 |
End posion on genome | 126612 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aatatgtagt |
tRNA gene sequence |
TCCGTGATAGCTCAGTCGGTAGAGCAAATGACTGTTAATCATTGGGTCCCAGGTTCGAGT |
Downstream region at tRNA end position |
atttcaaacc |
Secondary structure (Cloverleaf model) | >W1712005963 Asn GTT t GCCA atttcaaacc T - A C - G C - G G - C T - A G - C A - T T G T G G T C C A T G A A | | | | | G C C T C G C C A G G C G | | | | T T G G A G C T A A GGGTC A - T A - T T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |