Sequence ID | >W1712019992 |
Genome ID | NEYX01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Proteus mirabilis [NEYX] |
Start position on genome | 416948 |
End posion on genome | 417034 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acagaattta |
tRNA gene sequence |
GCCCAGGTGGTGAAATCGGTAGACACAAGGGATTTAAAATCCCTCGGCTGTAAGGCTGTG |
Downstream region at tRNA end position |
tctcttttag |
Secondary structure (Cloverleaf model) | >W1712019992 Leu TAA a ACCA tctcttttag G - C C - G C - G C - G A - T G - C G - C T G T C G C C C A T A A G | | | | | A C A G T G G C G G G C G | | | T T G A C A C T A G A CGGCTGTAAGGCTGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |