Sequence ID | >W1712037492 |
Genome ID | NFIG01000002 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Odoribacter splanchnicus [NFIG] |
Start position on genome | 312031 |
End posion on genome | 311955 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atgtcaaaac |
tRNA gene sequence |
GGCGAGGTAGCTCAGCTGGTTAGAGCGCATGATTCATAATCATGAGGTCGGCGGTTCAAG |
Downstream region at tRNA end position |
aactaaagat |
Secondary structure (Cloverleaf model) | >W1712037492 Met CAT c ACCA aactaaagat G + T G - C C - G G - C A - T G - C G + T C G T C C G C C A C G A A | | | | | A T C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A G - C A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |