Sequence ID | >W1712038713 |
Genome ID | NFJD01000001 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Elusimicrobium sp. An273 [NFJD] |
Start position on genome | 422160 |
End posion on genome | 422235 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tagtaaataa |
tRNA gene sequence |
GGGCCTGTAGCTCAGCTGGGAGAGCGCCTGCATGGCATGCAGGAGGTCGCAAGTTCGATC |
Downstream region at tRNA end position |
ttttttattt |
Secondary structure (Cloverleaf model) | >W1712038713 Ala GGC a ACCA ttttttattt G - C G - C G + T C - G C - G T - A G - C C T T T G T T C A C G A A + | | | | G T C T C G G C A A G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |