Sequence ID | >W1712043428 |
Genome ID | NFMU01000095 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter jejuni [NFMU] |
Start position on genome | 34381 |
End posion on genome | 34455 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ttttctgagc |
tRNA gene sequence |
GCTCGTATGGCTCAGAGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGCGGGTTCAATTC |
Downstream region at tRNA end position |
tgaattgaaa |
Secondary structure (Cloverleaf model) | >W1712043428 Thr GGT c TCCA tgaattgaaa G - C C - G T - A C - G G + T T - A A - T T T T C G C C C A G A G | | | | | A A C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |