Sequence ID | >W1712056862 |
Genome ID | NGBZ01000023 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Acinetobacter baumannii [NGBZ] |
Start position on genome | 392 |
End posion on genome | 317 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
taccaacgtt |
tRNA gene sequence |
GCGGGAGTAGCTCAGTTGGTAGAGCGGCAGCCTTCCAAGCTGCATGTCGCGAGTTCGATC |
Downstream region at tRNA end position |
tcgaaggata |
Secondary structure (Cloverleaf model) | >W1712056862 Gly TCC t TCCA tcgaaggata G - C C - G G - C G - C G - C A - T G - C C T T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G ATGTC G - C C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |