Sequence ID | >W1712106980 |
Genome ID | NIWW01000011 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Lacimicrobium sp. SS2-24 [NIWW] |
Start position on genome | 60355 |
End posion on genome | 60279 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcgaagaaat |
tRNA gene sequence |
GGCCCTTTAGCTCAGTTGGTTAGAGCACCCGACTCATAATCGGTAGGTCCCCAGTTCAAG |
Downstream region at tRNA end position |
tcttatcaat |
Secondary structure (Cloverleaf model) | >W1712106980 Met CAT t ACCA tcttatcaat G - C G - C C - G C - G C - G T + G T - A T G T G G G T C A T G A A | | | | | A T C T C G C C C A G C G | | | | T T G G A G C T T A A AGGTC C T C - G C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |