Sequence ID | >PL171000056 |
Genome ID | AP010951 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Azospirillum sp. B510 plasmid:pAB510e |
Start position on genome | 449929 |
End posion on genome | 449854 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gaagtatcgt |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCTACAATGGCATTGTAGAGGTCAGGAGTTCGATC |
Downstream region at tRNA end position |
cttctgaagg |
Secondary structure (Cloverleaf model) | >PL171000056 Ala GGC t ACCA cttctgaagg G - C G - C G + T G - C C - G C - G A - T C T T T C C T C A C G A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |