| Sequence ID | >PL171000101 |
| Genome ID | AP018191 |
| Phylum/Class | Cyanobacteria |
| Species | Nostoc sp. NIES-2111 plasmid:plasmid7 |
| Start position on genome | 22245 |
| End posion on genome | 22319 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
actggcacat |
| tRNA gene sequence |
TGCCCCATAGCTCAATGGCAGAGCAAGCGGCTGTTAACCGCGAGGTTGTAAGTTCGACTC |
| Downstream region at tRNA end position |
ttaattgcag |
| Secondary structure (Cloverleaf model) | >PL171000101 Asn GTT
t GCCA ttaattgcag
T - A
G - C
C - G
C - G
C - G
C - G
A - T T C
T C A T T C A
A A A | | | | | G
T C T C G G T A A G C
G | | | | T T
G G A G C
C A A AGGTT
A G
G - C
C - G
G - C
G - C
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |