Sequence ID | >PL171000107 |
Genome ID | AP018191 |
Search identical group | |
Phylum/Class | Cyanobacteria |
Species | Nostoc sp. NIES-2111 plasmid:plasmid7 |
Start position on genome | 22808 |
End posion on genome | 22882 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
accaaatctt |
tRNA gene sequence |
GGGCGTTTGGCAGAACGGTTATGCTCCTGACTCTTAATCAGGCTGACACAGGTTCAACTC |
Downstream region at tRNA end position |
aatttcaccc |
Secondary structure (Cloverleaf model) | >PL171000107 Lys CTT t ACCA aatttcaccc G - C G - C G - C C - G G - C T + G T - A T C T T G T C C A A A G | | | | | A C G A C G A C A G G C G | | | T T G A T G C T T T CTGAC C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |