Sequence ID | >PL171000146 |
Genome ID | AP018220 |
Search identical group | |
Phylum/Class | Cyanobacteria |
Species | Anabaena variabilis NIES-23 plasmid:plasmid4 |
Start position on genome | 5990 |
End posion on genome | 6064 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cctgctgtct |
tRNA gene sequence |
GGGGTCATAGCTCAACTGGCTAGAGCGTCCGCCTTGCAAGCGGGAGGTTAGGGGTTCAAA |
Downstream region at tRNA end position |
ttggtgtctg |
Secondary structure (Cloverleaf model) | >PL171000146 Ala TGC t ACtt ttggtgtctg G - C G - C G + T G + T T - A C - G A - T T A T T C C C C A C A A A | | | | | A T C T C G A G G G G C G | | | | T T G G A G C C T A G AGGTT T + G C - G C - G G - C C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |