Sequence ID | >PL171000152 |
Genome ID | AP018223 |
Search identical group | |
Phylum/Class | Cyanobacteria |
Species | Nostoc linckia NIES-25 plasmid:plasmid1 |
Start position on genome | 1132553 |
End posion on genome | 1132624 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gattgtgtac |
tRNA gene sequence |
GCCGATGTGGCTCAGTGGTAGAGCAGCTGATTCGTAATCAGCAGGCCGTGGGTTCAAATC |
Downstream region at tRNA end position |
atcaagtatt |
Secondary structure (Cloverleaf model) | >PL171000152 Thr CGT c Tttt atcaagtatt G - C C - G C - G G - C A - T T - A G - C T A T T A C C C A G A G + | | | | A T C T C G G T G G G C G | | | | T T G G A G C T A A AGGCC G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |