Sequence ID | >PL171000767 |
Genome ID | CP009998 |
Search identical group | |
Phylum/Class | Firmicutes |
Species | Bacillus thuringiensis serovar kurstaki HD 1 plasmid:unnamed1 |
Start position on genome | 271894 |
End posion on genome | 271820 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttacgcttt |
tRNA gene sequence |
GGACCTTTAGCTCAGCTGGTTAGAGCAAACGGCTCATAACCGTTCGGTCGTAGGTTCGAG |
Downstream region at tRNA end position |
ataaacaagg |
Secondary structure (Cloverleaf model) | >PL171000767 Met CAT t ACtt ataaacaagg G - C G - C A - T C - G C - G T - A T - A T G T C A T C C A C G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T T A A CGGTC A - T A - T C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |