Sequence ID | >PL171000896 |
Genome ID | CP012886 |
Search identical group | |
Phylum/Class | Actinobacteria |
Species | Mycobacterium chimaera AH16 plasmid:unnamed1 |
Start position on genome | 230776 |
End posion on genome | 230850 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ccgattctat |
tRNA gene sequence |
TGACCCGTAGTGTAATTGGTAGCACCACTGATTCTGGTTCAGTGGGTCTAGGTTCGAGTC |
Downstream region at tRNA end position |
caccagatgc |
Secondary structure (Cloverleaf model) | >PL171000896 Gln CTG t GCAA caccagatgc T - A G - C A - T C - G C - G C - G G - C T G T G G T C C A T A A A | + | | | G T T G T G C T A G G C G + | | | T T G G C A C T A C GGGT A - T C - G T - A G - C A - T T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |