Sequence ID | >PL171001148 |
Genome ID | CP015514 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio vulnificus FORC_036 plasmid:unnamed |
Start position on genome | 647634 |
End posion on genome | 647558 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccatatttt |
tRNA gene sequence |
GGAGATGTAGCTCAGTTGGTTAGAGCGGCGGTTTCATAGGCTGCATGTCGGGAGTTCAAT |
Downstream region at tRNA end position |
ttttgcgaga |
Secondary structure (Cloverleaf model) | >PL171001148 Met CAT t ACCA ttttgcgaga G - C G - C A - T G - C A - T T - A G - C T T T C T C T C A T G A A | + | | | A T C T C G G G G A G C G | | | | T T G G A G C T T A G ATGTC G - C C - G G + T G - C T + G T G T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |