Sequence ID | >PL171001150 |
Genome ID | CP015514 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio vulnificus FORC_036 plasmid:unnamed |
Start position on genome | 647474 |
End posion on genome | 647399 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
catccaattt |
tRNA gene sequence |
GTCTCGGTAGCTCAGTTGGTAGAGCGGAAGATTGAAGATCTTCGCGTCAGTGGTTCAATT |
Downstream region at tRNA end position |
tattttgcgt |
Secondary structure (Cloverleaf model) | >PL171001150 Phe GAA t ACCA tattttgcgt G - C T + G C - G T - A C - G G - C G + T T T T T C A C C A T G A A | | | | | A T C T C G A G T G G C G | | | | T T G G A G C T A G GCGTC G - C A - T A - T G - C A - T T A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |