Sequence ID | >PL171001329 |
Genome ID | CP018028 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Alteromonas mediterranea CP49 plasmid:MCP49-600 |
Start position on genome | 334735 |
End posion on genome | 334810 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
accaaacact |
tRNA gene sequence |
GCTGTGGTAGCTCAGTTGGTAGAGCATCGGATTGAAAATCCGAGTGTCACTGGTTCGATT |
Downstream region at tRNA end position |
atttgcgaaa |
Secondary structure (Cloverleaf model) | >PL171001329 Phe GAA t ACCA atttgcgaaa G - C C - G T - A G - C T + G G - C G + T T T T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T A A GTGTC T - A C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |