Sequence ID | >PL171001360 |
Genome ID | CP018784 |
Search identical group | |
Phylum/Class | Actinobacteria |
Species | Curtobacterium pusillum AA3 plasmid:pCPAA3 |
Start position on genome | 258581 |
End posion on genome | 258656 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cggctcctgc |
tRNA gene sequence |
GCCCCCATCGTTTAGAGGCCCAGGACACCGCCCTTTCACGGCGGATGCGCGGGTTCGAAT |
Downstream region at tRNA end position |
ccaacgtcgc |
Secondary structure (Cloverleaf model) | >PL171001360 Glu TTC c ACCA ccaacgtcgc G + T C - G C - G C - G C - G C - G A - T T A T C G C C C A A G A C | | | | | G G T T T G G C G G G C G + + | | T T C G G A C C C A A ATGC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |