Sequence ID | >PL171001406 |
Genome ID | CP019912 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | blood disease bacterium A2-HR MARDI plasmid:unnamed |
Start position on genome | 898559 |
End posion on genome | 898483 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
atcgtgggtt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGATTTGGGATCAGAGGGTCGCATGTTCGAA |
Downstream region at tRNA end position |
gaatttcagc |
Secondary structure (Cloverleaf model) | >PL171001406 Pro TGG t ACCA gaatttcagc C - G G - C G - C G - C G - C C - G G - C T A T T G T A C A C G A A + | | | | G C C G C G G C A T G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C A - T T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |