Sequence ID | >PL171001413 |
Genome ID | CP020040 |
Search identical group | |
Phylum/Class | Actinobacteria |
Species | Streptomyces sp. 3211 plasmid:p3211-1 |
Start position on genome | 299522 |
End posion on genome | 299598 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tcgagggcac |
tRNA gene sequence |
GGGGTGGTAGCTCAGTTGGTTAGAGCTGCGGACTTTTAATCCGTAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
cgcggccatc |
Secondary structure (Cloverleaf model) | >PL171001413 Lys TTT c ACTA cgcggccatc G - C G - C G - C G - C T - A G - C G - C C G T C A C C C A T G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T T A T AGGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |