Sequence ID | >A171000193 |
Genome ID | CP000855 |
Search identical group | |
Phylum/Class | Euryarchaeota |
Species | Thermococcus onnurineus NA1 [CP000855] |
Start position on genome | 288355 |
End posion on genome | 288442 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
acccgtagac |
tRNA gene sequence |
GCGGGGGTTGCCGAGCCTGGTCAAAGGCGGTGGACTCAAGATCCACTCCCGCAGGGGTTC |
Downstream region at tRNA end position |
ttctaacaaa |
Secondary structure (Cloverleaf model) | >A171000193 Leu CAA c ACCA ttctaacaaa G - C C - G G - C G - C G - C G - C G - C T A T G C C C C A C C G A T | | | | | A T G C C G C G G G G C G | | | T T G A G G C T C A A G TCCCGCAGGGGTTC G - C T - A G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |